BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112232 1 BBa_K112232 rbs.barstar! 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z <pre> Construction of {rbs.barstar!} Biobrick Part K112232 PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112232 ---------------------------------------- mea035 Forward Biobricking of {rbs.barstar!} cgataGAATTCatgAGATCTcataagaaaggagccgcacatg mea034 Reverse Biobricking of {rbs.barstar!} cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc </pre> ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2998 9 It's complicated true false Bing Xia BBa_K112373 1 BBa_K112373 {rbs_barstar!}{b1006 } 2008-10-28T12:00:00Z 2015-05-08T01:09:17Z BBa_K112232 and BBa_K112709 {rbs_barstar!}{b1006 } ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 Not in stock false <pre> Digest (BgIII methylated) BBa_K112232 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112373 </pre> false Aron Lau component1994836 1 BBa_K112999 component1994835 1 BBa_K112232 component1994837 1 BBa_K112709 annotation1994835 1 BBa_K112232 range1994835 1 1 292 annotation1994836 1 BBa_K112999 range1994836 1 293 298 annotation1994837 1 BBa_K112709 range1994837 1 299 338 BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112373_sequence 1 cataagaaaggagccgcacatgaaaaaagcagtcattaacggggaacaaatcagaagtatcagcgacctccaccagacattgaaaaaggagcttgcccttccggaatactacggtgaaaacctggacgctttatgggattgtctgaccggatgggtggagtacccgctcgttttggaatggaggcagtttgaacaaagcaagcagctgactgaaaatggcgccgagagtgtgcttcaggttttccgtgaagcgaaagcggaaggctgcgacatcaccatcatactttcttaaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112232_sequence 1 cataagaaaggagccgcacatgaaaaaagcagtcattaacggggaacaaatcagaagtatcagcgacctccaccagacattgaaaaaggagcttgcccttccggaatactacggtgaaaacctggacgctttatgggattgtctgaccggatgggtggagtacccgctcgttttggaatggaggcagtttgaacaaagcaagcagctgactgaaaatggcgccgagagtgtgcttcaggttttccgtgaagcgaaagcggaaggctgcgacatcaccatcatactttcttaa BBa_K112999_sequence 1 ggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z