BBa_K112400 1 BBa_K112400 Promoter for grpE gene - Heat Shock and Ultrasound Sensitive 2008-10-19T11:00:00Z 2015-05-08T01:09:17Z cloned from E. coli MG1655 genome According to Vollmer, et. al in their 1998 Applied and Enviormental Microbiology paper, "Bacterial Stress Responses to 1-Megahertz Pulsed Ultrasound in the Presence of Microbubble", the promoter for the grpE gene, a known heat shock promoter, is upregulated 24 times when cells are exposed to high frequency ultrasound and microbubble cavitation. false true _224_ 0 3241 9 It's complicated false none false Christina Brown BBa_K112400_sequence 1 ccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z