BBa_K1124000 1 amilGFP (+ amilGFP (+LVA), yellow reporter protein with degradation tag 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR (template: BBa_K592010, primers shown on our wiki(UT-Tokyo 2013)) amilGFP (+LVA) yellow reporter protein with degradation tag. The strong yellow color is visible to the naked eye under natural room light both in a LB liquid medium and on a LB agar plate. You can easily visualize gene expression without special equipment. Rapid degradation of the protein allows real-time imaging . It is also useful as a fluorescent reporter. For detailed usage, see UT-Tokyo 2013 wiki. This is the LVA tagged version of BBa_K592010. LVA tag was added to increase decay rate by PCR using the primers shown on our wiki (UT-Tokyo 2013). amilGFP is a coral fluorescent protein from Acropora millepora. It is a member of the GFP family. Excitation maximum : 503 nm Emission maximum : 512 nm Quantum yield : 0.67 Molar Extinction : 75200 LVA tag is one of the ssrA degradation tag, which decreases the protein half-life when added to the C-terminus. References Andersen, J. B., Sternberg, C., Poulsen, L. K., Bj??rn, S. P., Givskov, M., & Molin, S. (1998). New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Applied and environmental microbiology, 64(6), 2240-2246. Labas, Y. A., Gurskaya, N. G., Yanushevich, Y. G., Fradkov, A. F., Lukyanov, K. A., Lukyanov, S. A., & Matz, M. V. (2002). Diversity and evolution of the green fluorescent protein family. Proceedings of the National Academy of Sciences, 99(7), 4256-4261. false false _1436_ 0 13134 9 It's complicated false LVA tag(11 aa) was added by PCR. As in the previous study(1). Additional 2 aa (Stu1 restriction site) was also added, which may not be necessary for unstabilization of the protein. RPAANDENYALVA double stop codon [1]Andersen, J. B., Sternberg, C., Poulsen, L. K., Bj??rn, S. P., Givskov, M., & Molin, S. (1998). New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Applied and environmental microbiology, 64(6), 2240-2246. false Yuta Otsuka annotation2338833 1 amilGFP range2338833 1 1 699 annotation2338831 1 stop range2338831 1 733 735 annotation2338830 1 stop range2338830 1 736 738 annotation2338832 1 LVA degradation tag range2338832 1 700 732 BBa_K1124000_sequence 1 atgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z