BBa_K1124005 1 MicC scaff MicC sRNA scaffold (w/o antisense) 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR <em> E. coli</em> JM109 MicC sRNA scaffold (-antisense) false false _1436_ 0 13134 9 It's complicated false PCR false Yuta Otsuka annotation2339031 1 MicC scaffold range2339031 1 1 79 BBa_K1124005_sequence 1 tttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z