BBa_K1124006 1 BBa_K1124006 anti-mCherry sRNA 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR anti-mCherry sRNA false false _1436_ 0 13134 9 Not in stock false PCR false Yuta Otsuka annotation2339032 1 MicC scaffold range2339032 1 25 103 annotation2339033 1 Target-binding sequence range2339033 1 1 24 BBa_K1124006_sequence 1 atcctcctcgcccttgctcaccattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z