BBa_K112401 1 BBa_K112401 Promoter for recA gene - SOS and Ultrasound Sensitive 2008-10-20T11:00:00Z 2015-05-08T01:09:17Z Cloned from E. coli MG1655 genome. According to Vollmer, et. al in their 1998 Applied and Enviormental Microbiology paper, "Bacterial Stress Responses to 1-Megahertz Pulsed Ultrasound in the Presence of Microbubble", the promoter for the recA gene, a known SOS response gene, is upregulated 4 fold when cells are exposed to high frequency ultrasound and microbubble cavitation. false false _224_ 0 3241 9 It's complicated false We did not see the desired response from ultrasound exposure that we expected from this promoter. However, we did not induce the same acoustic cavitation that Vollmer et. al. used to elicit a response from this promoter. false Christina Brown BBa_K112401_sequence 1 agagaagcctgtcggcaccgtctggtttgcttttgccactgcccgcggtgaaggcattacccggcgggaatgcttcagcggcgaccgtgatgcggtgcgtcgtcaggctactgcgtatgcattgcagaccttgtggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z