BBa_K112402 1 BBa_K112402 promoter for FabA gene - Membrane Damage and Ultrasound Senstitive 2008-10-20T11:00:00Z 2015-05-08T01:09:17Z cloned from E. coli MG1655 genome According to Vollmer, et. al in their 1998 Applied and Enviormental Microbiology paper, "Bacterial Stress Responses to 1-Megahertz Pulsed Ultrasound in the Presence of Microbubble", the promoter for the fabA gene, a known membrane damage response gene, is upregulated seven fold when cells are exposed to high frequency ultrasound and microbubble cavitation. false false _224_ 0 3241 9 It's complicated false none false Christina Brown BBa_K112402_sequence 1 ggccattacgttggctgaactggtttattccgaactgatcggacttgttcagcgtacacgtgttagctatcctgcgtgcttcaataaaataaggcttacagagaacatggtagataaacgcgaatcctatacaaaagaagaccttcttgcctctggtcgcggtgaactgtttggcgctaaaggcccgcaattgccagcaccgaacatgctgatgatggaccgtgtggtcaaaatgaccgaaacgggtggtaacttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z