BBa_K112407 1 BBa_K112407 Promoter for ygeF psuedogene 2008-10-20T11:00:00Z 2015-05-08T01:09:17Z Cloned from E. coli MG1655 genome This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. In a Bca1256 plasmid backbone. Our microarray results showed that this gene was upregulated four fold in response to low frequency ultrasound and two fold in response to audible sound. We cloned approximately 400 base pairs upstream from the start codon for the ygeF pseudogene. false false _224_ 0 3241 9 It's complicated false none false Christina Brown BBa_K112407_sequence 1 cagtttactcagtgaatcaatagaggaaaggactaacgtttctttaaaagaattgatttcatcatctgttaaactaaactcatcattgacagatcgtgagatataactgtttttaactttactctttacgttgactttattgacagaattaacattcacatatcttgaatttaatgtccatgatgttgtttgcgtgagaacattctcagcattaaggaatttttttaacggaatccttggtttctttttcgagtccgaatttacaatatcatgcatatagaccatttcatgaatctgcgaaaattcaatgtccattgtatacctcacatttttaccgtgactcgatgttactgttcaataatcaccttccatcaatactaaaattaatacccctaatgtgccgataacaaatatagtcattctacgtaacgtctccataaggtgatatttgacattatcagaagctgcgaattgggattttgctctaatcaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z