BBa_K1124106 1 BBa_K1124106 plambda-sRNA(anti-tyrR)-plambda-sRNA (anti-csrA) (tyrosine synthesis device) 2013-09-14T11:00:00Z 2015-05-08T01:09:17Z Coming soon! Coming soon! false false _1436_ 0 13160 9 Not in stock false Coming soon! false Takahiro Yamada component2352035 1 BBa_R0051 component2352049 1 BBa_K1124116 component2352051 1 BBa_R0051 component2352065 1 BBa_K1124117 annotation2352051 1 BBa_R0051 range2352051 1 306 354 annotation2352035 1 BBa_R0051 range2352035 1 1 49 annotation2352065 1 BBa_K1124117 range2352065 1 363 602 annotation2352049 1 BBa_K1124116 range2352049 1 58 297 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2023 1 -35 range2023 1 15 20 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 annotation2024 1 OR1 range2024 1 25 41 BBa_K1124116 1 BBa_K1124116 anti-tyrR sRNA (+termintor) (sRNA generator) 2013-09-14T11:00:00Z 2015-05-08T01:09:17Z Coming soon! Coming soon! false false _1436_ 0 13160 9 It's complicated false Coming soon! false Takahiro Yamada component2341878 1 BBa_B0015 component2341871 1 BBa_K1124009 annotation2341871 1 BBa_K1124009 range2341871 1 1 103 annotation2341878 1 BBa_B0015 range2341878 1 112 240 BBa_K1124010 1 BBa_K1124010 anti-csrA sRNA 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR anti-csrA sRNA false false _1436_ 0 13134 9 Not in stock false PCR false Yuta Otsuka annotation2339041 1 Target-binding sequence range2339041 1 1 24 annotation2339039 1 MicC scaffold range2339039 1 25 103 BBa_K1124117 1 BBa_K1124117 anti-csrA sRNA (+termintor) (sRNA generator) 2013-09-14T11:00:00Z 2015-05-08T01:09:17Z Coming soon! Coming soon! false false _1436_ 0 13160 9 It's complicated false Coming soon! false Takahiro Yamada component2341868 1 BBa_B0015 component2341861 1 BBa_K1124010 annotation2341868 1 BBa_B0015 range2341868 1 112 240 annotation2341861 1 BBa_K1124010 range2341861 1 1 103 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1124009 1 BBa_K1124009 anti-tyrR sRNA 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR anti-tyrR sRNA false false _1436_ 0 13134 9 Not in stock false PCR false Yuta Otsuka annotation2339040 1 Target-binding sequence range2339040 1 1 24 annotation2339038 1 MicC scaffold range2339038 1 25 103 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1124106_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagttcacaaaagacttccagacgcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaactcgacgagtcagaatcagcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1124010_sequence 1 aactcgacgagtcagaatcagcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt BBa_K1124009_sequence 1 ttcacaaaagacttccagacgcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt BBa_K1124117_sequence 1 aactcgacgagtcagaatcagcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_K1124116_sequence 1 ttcacaaaagacttccagacgcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z