BBa_K1124116 1 BBa_K1124116 anti-tyrR sRNA (+termintor) (sRNA generator) 2013-09-14T11:00:00Z 2015-05-08T01:09:17Z Coming soon! Coming soon! false false _1436_ 0 13160 9 It's complicated false Coming soon! false Takahiro Yamada component2341871 1 BBa_K1124009 component2341878 1 BBa_B0015 annotation2341878 1 BBa_B0015 range2341878 1 112 240 annotation2341871 1 BBa_K1124009 range2341871 1 1 103 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1124009 1 BBa_K1124009 anti-tyrR sRNA 2013-09-10T11:00:00Z 2015-05-08T01:09:17Z PCR anti-tyrR sRNA false false _1436_ 0 13134 9 Not in stock false PCR false Yuta Otsuka annotation2339040 1 Target-binding sequence range2339040 1 1 24 annotation2339038 1 MicC scaffold range2339038 1 25 103 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1124009_sequence 1 ttcacaaaagacttccagacgcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt BBa_K1124116_sequence 1 ttcacaaaagacttccagacgcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z