BBa_K773003 1 BBa_K773003 mCherry-LVA 2012-09-30T11:00:00Z 2015-05-08T01:13:15Z This part was modified from a plasmid provided by the Murray lab at Caltech. Released HQ 2013 This part contains the fluorescent protein mCherry attached to a degradation tag. It will decrease the amount of fluorescent protein over time. false false _1025_ 0 11646 9 In stock false We modified the AAV sequence to LVA with PCR. false Katie Knister annotation2209512 1 Stop range2209512 1 760 762 annotation2209508 1 B0034 range2209508 1 1 12 annotation2209510 1 Start range2209510 1 19 21 annotation2209513 1 Stop range2209513 1 763 765 annotation2209511 1 ssrA degradation tag: LVA range2209511 1 730 759 annotation2209509 1 mCherry-LVA range2209509 1 19 765 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1124207 1 BBa_K1124207 pLux/tet-mCherry 2013-09-14T11:00:00Z 2015-05-08T01:09:17Z Coming soon! Coming soon! false false _1436_ 0 13160 9 In stock false Coming soon! false Takahiro Yamada component2344460 1 BBa_K176000 component2344467 1 BBa_K773003 component2344474 1 BBa_B0015 annotation2344460 1 BBa_K176000 range2344460 1 1 72 annotation2344474 1 BBa_B0015 range2344474 1 854 982 annotation2344467 1 BBa_K773003 range2344467 1 81 845 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K176000 1 pLux/Tet pLux/Tet Hybrid Promoter: (LuxR+,TetR-)->PoPS 2009-05-05T11:00:00Z 2015-05-08T01:11:00Z Tet Operator sequence from BBa_R0040 sense TWO INPUTS, activation by AHL and repression by tetR false false _282_ 0 4010 9 It's complicated true How to arrange the two parts together? false Danqian Liu, Chao Li, Hao Jiang annotation2002609 1 -10 range2002609 1 42 47 annotation2002608 1 -35 range2002608 1 20 25 annotation2002611 1 +1 range2002611 1 53 53 annotation2002612 1 luxR/HSL range2002612 1 1 20 annotation2002610 1 tetR range2002610 1 54 72 annotation2002607 1 R0062 range2002607 1 1 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K176000_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatatccctatcagtgatagaga BBa_K1124207_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatatccctatcagtgatagagatactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaaggcagcaaacgacgaaaactacgctctagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K773003_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaaggcagcaaacgacgaaaactacgctctagtagcttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z