BBa_K112502 1 BBa_K112502 < myc > in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {<myc>} basic part K112502 Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112502 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc005 Reverse Biobricking of {<myc>} ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG </pre> This is a myc tag without a stop or a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112502_sequence 1 gaacaaaaactcatctcagaagaggatctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z