BBa_K1126001 1 BBa_K1126001 TetR aptamer 12_1P 2013-09-12T11:00:00Z 2015-05-08T01:09:18Z http://www.sciencedirect.com/science/article/pii/S1074552109000064 This part is an RNA aptamer that induces TetR-controlled gene expression in Escherichia coli when expressed in the cell. The aptamer was found by a combined approach of in vitro selection for TetR binding and in vivo screening for TetR induction. The smallest active aptamer folds into a stem-loop with an internal loop interrupting the stem. The TetR-inducing activity of the aptamer directly correlates with its stability and the best construct is as efficient as the natural inducer tetracycline. Because of its small size, high induction efficiency, and the stability of the TetR aptamer under in vivo conditions, it is well suited to be an alternative RNA-based inducer of TetR-controlled gene expression. false false _1438_ 0 13934 9 In stock false Nothing false Kanji Nakagawa BBa_K1126001_sequence 1 gagatagtatcaagcagcatgttatgggtcatcacagaccagagaaaagcttgatacaaaggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z