BBa_K1126003 1 BBa_K1126003 pT181 attenuator 2013-09-12T11:00:00Z 2015-05-08T01:09:18Z Takahashi, M. K., & Lucks, J. B. (2013). A modular strategy for engineering orthogonal chimeric RNA transcription regulators. Nucleic Acids Research. pT181 attenuator is the locus where regulates the transcription of downstream gene with pT181 antisense (BBa_K1126006) if it is located between promoter and ribosome binding site. <br> In the absence of pT181 antisense, tertiary structure of pT181 attenuator locus does not affect transcription. However, when mRNA of this locus is partly coupled complementary with mRNA of pT181 antisense, this locus is folded into Rho-independent terminator and terminates the transcription right before the gene. The efficiency of pT181 antisense termination is very high and downstream gene is completely silenced.<br> Although this mechanism is originally found in the regulation system of plasmid pT181 in gram negative bacteria <i>Staphylococcus aureus</i>, it is confirmed that this can be used in <i>Escherichia coli</i>. false false _1438_ 0 17613 9 It's complicated false Nothing false Keita Kinose BBa_K1126003_sequence 1 aacaaaataaaaaggagtcgctcacgccctgaccaaagtttgtgaacgacatcattcaaagaaaaaaacactgagttgtttttataatcttgtatatttagatattaaacgatatttaaatatacataaagatatatatttgggtgagcgattccttaaacgaaattgagattaaggagtcgctcttttttatgtataaaaacaatcatgcaaatcattcaaatcatttggaaaatcacgatttagacaatttttctaaaaccggctactctaatagccggttgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z