BBa_K1126004 1 BBa_K1126004 Fusion3m2 attenuator 2013-09-12T11:00:00Z 2015-05-08T01:09:18Z Takahashi, M. K., & Lucks, J. B. (2013). A modular strategy for engineering orthogonal chimeric RNA transcription regulators. Nucleic Acids Research. Fusion3m2 attenuator is the locus where regulates the transcription of downstream gene with Fusion 6 antisense (BBa_K1126007) if it is located between promoter and ribosome binding site. <br> In the absence of antisense RNA, secondary structure of Fusion3m2 attenuator locus does not affect transcription. However, when mRNA of this locus is partly coupled complementary with mRNA of Fusion6 antisense, this locus is folded into Rho-independent terminator and terminates the transcription right before the gene. Downstream gene is somewhat silenced by this mechanism (the efficiency is shown to be 44% in <i>Escherichia coli</i>). <br> This mechanism is originally found in the regulation system of plasmid pT181 in gram negative bacteria <i>Staphylococcus aureus</i>, and Fusion3m2 attenuator is made by arranging the sequence. false false _1438_ 0 17613 9 It's complicated false Nothing false Keita Kinose BBa_K1126004_sequence 1 aacaaaataaaaaggagtcgctcacgcaccgaacttggcggaacgtcgtgtgaacgacatcattcaaagaaaaaaacactgagttgtttttataatcttgtatatttagatattaaacgatatttaaatatacataaagatatatatttgggtgagcgattccttaaacgaaattgagattaaggagtcgctcttttttatgtataaaaacaatcatgcaaatcattcaaatcatttggaaaatcacgatttagacaatttttctaaaaccggctactctaatagccggttgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z