BBa_K1126006 1 BBa_K1126006 pT181 antisense 2013-09-12T11:00:00Z 2015-05-08T01:09:18Z Takahashi, M. K., & Lucks, J. B. (2013). A modular strategy for engineering orthogonal chimeric RNA transcription regulators. Nucleic Acids Research. pT181 antisense is the functional RNA which regulates the transcription of downstream gene of pT181 attenuator (BBa_K1126003). <br> In the absence of pT181 antisense, secondary structure of pT181 attenuator locus does not affect transcription. However, when mRNA of this locus is partly coupled complementary with pT181 antisense RNA, this locus is folded into Rho-independent terminator and terminates the transcription right before the gene. The efficiency of this termination is very high and downstream gene is strongly silenced (the efficiency is shown to be 84% in <i>Escherichia coli</i>). <br> This mechanism is originally found in the regulation system of plasmid pT181 in gram negative bacteria <i>Staphylococcus aureus</i>. false false _1438_ 0 17613 9 It's complicated false Nothing false Keita Kinose BBa_K1126006_sequence 1 atacaagattataaaaacaactcagtgtttttttctttgaatgatgtcgttcacaaactttggtcagggcgtgagcgactcctttttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z