BBa_K112603 1 BBa_K112603 < FLAG tag ! in BBb 2008-09-02T11:00:00Z 2015-05-08T01:09:18Z Construction of {<FLAG!} basic part K112603 Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112603 ----------------------------------------------------- SC004 Forward Biobricking of <FLAG-tag! cgataGAATTCatgAGATCTgactacaaggatgacgacg SC006 Reverse Biobricking of <FLAG-tag! ccagtGGATCCttacttgtcgtcgtcatccttgtagtc This is a FLAG tag with a stop codon, but no start codon. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112603_sequence 1 gactacaaggatgacgacgacaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z