BBa_K112611 1 BBa_K112611 LamB pp> in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {LamB>} basic part K112611 PCR cb10009/sc014 on MG1655 (107 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ cb10009 Fwd biobricking of {prepro>} cgataGAATTCatgAGATCTatgatgattactctgcgcaaac sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac </pre> This is a lamB prepro with a start, but without a stop codon. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112611_sequence 1 atgatgattactctgcgcaaacttcctctggcggttgccgtcgcagcgggcgtaatgtctgctcaggcaatggct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z