BBa_K112615 1 BBa_K112615 rbs.LamB pp> in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {rbs_LamB>} basic part K112615 PCR sc011/sc014 on MG1655 (126 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc011 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTcaatgactcaggagatagaatg sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac </pre> This is a lambB prepro with a native rbs and start codon, but without a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated false N/A false Sherine Cheung BBa_K112615_sequence 1 caatgactcaggagatagaatgatgattactctgcgcaaacttcctctggcggttgccgtcgcagcgggcgtaatgtctgctcaggcaatggct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z