BBa_K112616 1 BBa_K112616 {< AP !}.{b1006} in BBb 2008-09-02T11:00:00Z 2015-05-08T01:09:18Z Composite part of K112601 and K112### This is a composite part. AP tag with no start but a stop codon is the lefty parent of the part; terminator b1006 is the righty parent of the part. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page} true false _224_ 0 3386 9 Discontinued false N/A false Sherine Cheung BBa_K112616_sequence 1 ggcctgaacgatatttttgaagcgcagaaaattgaatggcatgaataaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z