BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112618 1 BBa_K112618 < HA! . b1006 in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z K112507 assembled with K112709 This is a composite part. HA tag with no start but a stop codon is the lefty parent of the part; terminator b1006 is the righty parent of the part. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 Not in stock false N/A false Sherine Cheung component1984051 1 BBa_K112507 component1984052 1 BBa_K112999 component1984053 1 BBa_K112709 annotation1984053 1 BBa_K112709 range1984053 1 40 79 annotation1984052 1 BBa_K112999 range1984052 1 34 39 annotation1984051 1 BBa_K112507 range1984051 1 1 33 BBa_K112507 1 BBa_K112507 < HA ! in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {<HA!} basic part K112507 Wobble PCR of cc001/cc011 ( 54 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112507 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc011 Reverse biobricking of {<HA!} ccagtggatccttacccagcgtagtctgggacgtcgtatgggtaag </pre> This is an HA tag without a start, but with a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112618_sequence 1 tacccatacgacgtcccagactacgctgggtaaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112507_sequence 1 tacccatacgacgtcccagactacgctgggtaa BBa_K112999_sequence 1 ggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z