BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112503 1 BBa_K112503 < myc ! in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {<myc!} basic part K112503 Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L) Product is pBca1256-K112503 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc006 Reverse Biobricking of {<myc!} ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC </pre> This is a myc tag without a start, but with a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112619 1 BBa_K112619 {<myc!}.{b1006} in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z K112503 assembled with K112709 <myc!.b1006 This is a composite part. Myc tag with no start but a stop codon is the lefty parent of the part; terminator b1006 is the righty parent of the part. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 Not in stock false N/A false Sherine Cheung component1984055 1 BBa_K112999 component1984054 1 BBa_K112503 component1984056 1 BBa_K112709 annotation1984055 1 BBa_K112999 range1984055 1 34 39 annotation1984056 1 BBa_K112709 range1984056 1 40 79 annotation1984054 1 BBa_K112503 range1984054 1 1 33 BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112503_sequence 1 gaacaaaaactcatctcagaagaggatctgtaa BBa_K112619_sequence 1 gaacaaaaactcatctcagaagaggatctgtaaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112999_sequence 1 ggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z