BBa_K1127000 1 BBa_K1127000 A3-Flg Gold binding peptide 2013-09-07T11:00:00Z 2015-05-08T01:09:18Z Completely synthetic A de novo synthesized gene with A3 and Flg domains which should hypothetically bind to gold and form nanoparticles. false false _1439_ 0 16991 9 In stock false N/A false Jonas Kondratavicius annotation2336253 1 A3-Flg range2336253 1 91 156 annotation2336254 1 SanDI range2336254 1 158 164 annotation2336251 1 rbs range2336251 1 8 18 annotation2336250 1 SacII range2336250 1 1 6 annotation2336252 1 pelB range2336252 1 25 90 BBa_K1127000_sequence 1 ccgcggaaagaggagaaatactagatgaaatacctgctgccgaccgctgctgctggtctgctgctgctggctgctcagccggctatggctgcttactcttctggtgctccgccgatgccgccgttcccggactacaaagacgacgacgacaaataaggggtccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z