BBa_K1127003 1 BBa_K1127003 MIDAS2 gold binding peptide 2013-09-07T11:00:00Z 2015-05-08T01:09:18Z Completely synthetic MIDAS2 is a gold binding synthetic peptide. We synthesized a gene expressing this peptide with a pelB signaling sequence to be excreted out of the E. coli. false false _1439_ 0 16991 9 In stock false N/A false Jonas Kondratavicius annotation2336271 1 pelB range2336271 1 25 90 annotation2336273 1 SanDI range2336273 1 131 137 annotation2336269 1 SacII range2336269 1 1 6 annotation2336272 1 MIDAS2 range2336272 1 91 129 annotation2336270 1 rbs range2336270 1 7 18 BBa_K1127003_sequence 1 ccgcggaaagaggagaaatactagatgaaatacctgctgccgaccgctgctgctggtctgctgctgctggctgctcagccggctatggctaccggtacctctgttctgatcgctaccccgtacgtttaaggggtccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z