BBa_K1127008 1 BBa_K1127008 Gold sensing device (PgolTS+LacZ+GolS) 2013-09-04T11:00:00Z 2015-05-08T01:09:18Z The part itself was synthesized fully [i]de novo[/i]. DNA sequence for PgolTS comes from Salmonela enterica as does the amino acid sequence for GolS (DNA sequence is different however). This is the device we use in our project so that the cell could recognize the presence of gold in it's environment. GolS protein acts as a positive transcriptional regulator on PgolTS once it binds to gold. Part was designed so that you can detect and quantify the activity of the promoter via Beta-galactosidase assay. For convenience the ORF of LacZ is covered by restriction sites of SacII and SanDI which allows the cell to respond to gold by expressing something to meet your needs. false false _1439_ 0 16991 9 In stock false N/A false York iGEM 2013 annotation2334988 1 rbs range2334988 1 272 283 annotation2334982 1 GFP wat? range2334982 1 64 77 annotation2334981 1 SandI range2334981 1 265 271 annotation2334977 1 PgolTS range2334977 1 1 39 annotation2334979 1 rbs range2334979 1 46 57 annotation2334989 1 GolS range2334989 1 290 754 annotation2334978 1 SacII range2334978 1 40 45 annotation2334980 1 lacZ-alpha range2334980 1 78 263 BBa_K1127008_sequence 1 cttgaccttcccacaatggcaagctttaggctttctgatccgcggaaagaggagaaatactagatgaactatacaaaatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctaataaggggtcccaaagaggagaaaactagaatgaacatcggtaaagctgctaaagcttctaaagtttctgctaaaatgatccgttactacgaacagatcggtctgatcccggctgcttctcgtaccgactctggttaccgtgcttacacccaggctgacgttaaccagctgcacttcatccgtcgtgctcgtgacctgggtttctctgttgctgaaatctctgacctgctgaacctgtggaacaaccagtctcgtcagtctgctgacgttaaacgtctggctcagacccacatcgacgaactggaccgtcgtatccagaacatgcagcacatggctcagaccctgaaagctctgatccactgctgcgctggtgacgctctgccggactgcccgatcctgcacaccctgggtcagccggacgactctgaaccggaagctcgtaccggtgctgttctgcgtcgtccgcgtcgtcacggtctggctaaacgtctgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z