BBa_K112705 1 S S affinity tag 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of S-tag> basic part K112705 Wobble PCR dv013/dv014 (47 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+47, L) Product is pBca1256-K112705 ----------------------------------------------- dv013 Forward Biobricking of S-Tag> cgataGAATTCatgAGATCTatgaaagaaaccgctgctgctaaattcg dv014 Reverse Biobricking of S-Tag> cgttaGGATCCgctgtccatgtgctggcgttcgaatttagcagcagcgg </pre> This S-tag can be added between two protein parts. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112705_sequence 1 atgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z