BBa_K112708 1 BBa_K112708 PfhuA 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <PfhuA> basic part K112708 PCR of dv019/dv020 on MG1655 (225bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) Product is pBca1256-K112708 ----------------------------------------------- dv019 Forward biobricking of <PfhuA> cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg dv020 Reverse biobricking of <PfhuA> cgttaGGATCCactctgatgtaaagtgaatgataacg </pre> The fhuA promoter. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112708_sequence 1 gctaagcgtgaaataccggatggcgagttgccatccggtaaaataacatcccatctaagatattaaccctttcttttcatctggttgtttattaacccttcaggaacgctcagattgcgtaccgcttgcgaacccgccagcgtttcgaatattatcttatctttataataatcattctcgtttacgttatcattcactttacatcagagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z