BBa_K1129014 1 BBa_K1129014 CaMXMT1 under pTET constitutive promoter 2013-08-29T11:00:00Z 2015-05-08T01:09:19Z The constitutive promoter comes from part BBa_J23118, found in Plate 1 of the 2012 Distribution Kit. The gene comes from TU Munich 2012 part BBa_K801071 in the 2013 Distribution Kit. CaMXMT1 is the gene coding for the second enzyme of the caffeine biosynthesis pathway, known as 7-methylxanthosine N-methyltransferase or theobromine synthase, when starting with xanthosine as substrate. TU Munich's 2012 team isolated this gene and added a strep tag at the end, in addition to transferring it all into yeast. We modified it further by removing the yeast consensus sequence and placing the gene and strep tag behind a constitutive promoter and bacterial consensus sequence. This system was transformed into a prokaryote, specifically E. coli strain K12. We have yet to test for expression, and we may find that codon optimization is needed. false false _1441_ 0 12783 9 It's complicated false Codon optimization has not yet been performed, but we suspect it may be needed for successful expression in a prokaryotic system. false UBC iGEM 2013 component2365591 1 BBa_J23118 component2365606 1 BBa_B0015 component2365593 1 BBa_B0034 component2365599 1 BBa_K801071 annotation2365593 1 BBa_B0034 range2365593 1 44 55 annotation2365606 1 BBa_B0015 range2365606 1 1248 1376 annotation2365591 1 BBa_J23118 range2365591 1 1 35 annotation2365599 1 BBa_K801071 range2365599 1 64 1239 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K801071 1 BBa_K801071 7-methylxanthine N-methyltransferase CaMXMT1-strep 2012-09-20T11:00:00Z 2015-05-08T01:13:24Z Synthesized by IDT, Yeast codon optimized Released HQ 2013 7-methylxanthine N-methyltransferase CaMXMT1 from ''Coffea arabica'' followed by a strep-tag for purification and/or detection via western blot. false false _1057_ 0 11966 9 In stock false - false Roman Prechtl annotation2198148 1 Strep Tag range2198148 1 1141 1170 annotation2198586 1 Start codon range2198586 1 7 9 annotation2197709 1 CaMXMT1 range2197709 1 7 1140 annotation2197876 1 Consensus sequence range2197876 1 1 6 annotation2198587 1 Stop codon range2198587 1 1171 1176 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J23118 1 BBa_J23118 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1129014_sequence 1 ttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagagtacacaatgtctttacaagaagtcttgcacatgaacgaaggtgaaggtgatacttcttacgctaagaatgcttcttacaacttggctttggctaaggttaagccattcttggaacaatgcatcagagaattattgagagccaacttgccaaacatcaacaagtgtattaaggttgctgatttgggttgtgcttctggtccaaatactttgttgactgttagagacatcgtccaatccattgataaggttggtcaagaagaaaagaacgaattggaaagaccaaccatccaaattttcttgaacgacttgttccaaaacgacttcaactccgtttttaagttgttgccatccttctacagaaagttggaaaaagaaaacggtagaaagatcggttcctgcttgatttctgctatgccaggttctttttacggtagattattccctgaagaatccatgcatttcttgcactcttgttactctgttcactggttgtctcaagttccatctggtttggttattgaattgggtattggtgctaacaagggttccatctattcttctaaaggttgtagaccaccagttcaaaaggcttacttggatcaattcactaaggacttcaccactttcttgagaatccactccaaagaattattctccagaggtagaatgttgttgacctgtatctgtaaggttgacgaatttgatgaacctaacccattggatttgttggatatggccattaacgatttgatcgtcgaaggtttgttggaagaagaaaagttggactccttcaacattccattctttactccatctgccgaagaagttaagtgcatcgttgaagaagaaggttcttgcgaaatcttgtacttggaaactttcaaggctcattacgatgctgccttctctattgatgatgattacccagttagatcccacgaacaaatcaaagctgaatacgttgcctccttgatcagatctgtttacgaacctattttggcctctcatttcggtgaagctattatgccagatttgtttcacagattggctaaacatgctgctaaggttttacacatgggtaagggttgttacaacaacttgattatctccttggccaaaaagccagaaaagtctgatgtttctgcttggtcacatccacaattcgaaaagtgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K801071_sequence 1 tacacaatgtctttacaagaagtcttgcacatgaacgaaggtgaaggtgatacttcttacgctaagaatgcttcttacaacttggctttggctaaggttaagccattcttggaacaatgcatcagagaattattgagagccaacttgccaaacatcaacaagtgtattaaggttgctgatttgggttgtgcttctggtccaaatactttgttgactgttagagacatcgtccaatccattgataaggttggtcaagaagaaaagaacgaattggaaagaccaaccatccaaattttcttgaacgacttgttccaaaacgacttcaactccgtttttaagttgttgccatccttctacagaaagttggaaaaagaaaacggtagaaagatcggttcctgcttgatttctgctatgccaggttctttttacggtagattattccctgaagaatccatgcatttcttgcactcttgttactctgttcactggttgtctcaagttccatctggtttggttattgaattgggtattggtgctaacaagggttccatctattcttctaaaggttgtagaccaccagttcaaaaggcttacttggatcaattcactaaggacttcaccactttcttgagaatccactccaaagaattattctccagaggtagaatgttgttgacctgtatctgtaaggttgacgaatttgatgaacctaacccattggatttgttggatatggccattaacgatttgatcgtcgaaggtttgttggaagaagaaaagttggactccttcaacattccattctttactccatctgccgaagaagttaagtgcatcgttgaagaagaaggttcttgcgaaatcttgtacttggaaactttcaaggctcattacgatgctgccttctctattgatgatgattacccagttagatcccacgaacaaatcaaagctgaatacgttgcctccttgatcagatctgtttacgaacctattttggcctctcatttcggtgaagctattatgccagatttgtttcacagattggctaaacatgctgctaaggttttacacatgggtaagggttgttacaacaacttgattatctccttggccaaaaagccagaaaagtctgatgtttctgcttggtcacatccacaattcgaaaagtgatga BBa_J23118_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z