BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I742107 1 COMT COMT 2007-10-18T11:00:00Z 2015-08-31T04:08:02Z Alfalfa cDNA Genes and Enzymes Involved in Caffeic Acid Biosynthesis in the Actinomycete Saccharothrix esanaensis, Berner M, et al, Journal of Bacteriology 188(7): 2666, (2006) Gowri G, et al, Molecular cloning and expression of alfalfa S-adenosyl-L-methionine: caffeic acid 3-0-methyltransferase, a key enzyme of lignin biosynthesis, Plant Physiology 97(1):7 (1991) Downregulation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl CoA 3-O-Methyltransferase in Transgenic Alfalfa Impacts on Lignin Structure and Implications for the Biosynthesis of G and S Lignin, Guo D, et al, Plant Cell. January; 13(1): 73 (2001) Released HQ 2013 COMT coding sequence Encodes caffeic acid-O-methyl transferase (methylates -OH on C4 of the aromatic ring) from Medicago sativa (alfalfa), synthesised by Geneart false false _123_ 0 1964 9 In stock true Used cDNA as coding gene in Alfalfa genome contains introns. true sarah hollingshead annotation1949817 1 COMT coding region range1949817 1 1 1101 BBa_I742109 1 rbs+COMT COMT gene with ribosome binding site 2007-10-18T11:00:00Z 2015-08-31T04:08:02Z Genes and Enzymes Involved in Caffeic Acid Biosynthesis in the Actinomycete Saccharothrix esanaensis, Berner M, et al, Journal of Bacteriology 188(7): 2666, (2006) Gowri G, et al, Molecular cloning and expression of alfalfa S-adenosyl-L-methionine: caffeic acid 3-0-methyltransferase, a key enzyme of lignin biosynthesis, Plant Physiology 97(1):7 (1991) Downregulation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl CoA 3-O-Methyltransferase in Transgenic Alfalfa Impacts on Lignin Structure and Implications for the Biosynthesis of G and S Lignin, Guo D, et al, Plant Cell. January; 13(1): 73 (2001) Released HQ 2013 COMT (caffeic acid-O-methyl transferase) with ribosome binding site. Enzyme methylates -OH on C4 of the caffeic acid aromatic ring to produce ferulic acid. COMT is the third gene in the vanillin biosynthesis pathway, false false _123_ 0 1964 9 In stock true Used COMT cDNA as genomic DNA contains introns true sarah hollingshead component1949771 1 BBa_I742107 component1949770 1 BBa_J15001 annotation1949770 1 BBa_J15001 range1949770 1 1 10 annotation1949771 1 BBa_I742107 range1949771 1 17 1117 BBa_K1129041 1 BBa_K1129041 Caffeic acid-o-methyltransferase under pTET constitutive promoter 2013-09-15T11:00:00Z 2015-05-08T01:09:19Z Registry Const.+rbc+COMT+term false false _1441_ 0 9774 9 It's complicated true Const.+rbc+COMT+term false UBC iGEM 2013 component2348722 1 BBa_I742109 component2348729 1 BBa_B0015 component2348717 1 BBa_B0034 component2348715 1 BBa_J23118 annotation2348722 1 BBa_I742109 range2348722 1 64 1180 annotation2348717 1 BBa_B0034 range2348717 1 44 55 annotation2348715 1 BBa_J23118 range2348715 1 1 35 annotation2348729 1 BBa_B0015 range2348729 1 1189 1317 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938046 1 rbs range1938046 1 4 10 annotation1938045 1 SacI range1938045 1 1 3 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_J23118 1 BBa_J23118 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1129041_sequence 1 ttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagagctcaaggaggtactagatgggttcaacaggtgaaactcaaataacaccaacccacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcttcagttcttcccatgattttgaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctaccaacaactaaccctgatgcaccagttatgttggaccgaatgttgcgtctcttggcttgttacataatcctcacatgttcagttcgtactcaacaagatggaaaggttcagagactttatggtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaatctcatgaatcaggataaagtgctcatggaaagctggtaccacctaaaagatgcagtccttgatgggggcattccattcaacaaggcttatggaatgacagcctttgaataccatggaacagatccaaggtttaacaaggttttcaacaaggggatgtctgatcactctaccatcacaatgaagaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtggtggtactggagctgtaattaacacgattgtctcaaaatatcccactataaagggtataaattttgatttaccccatgtcattgaagatgctccatcttatccaggagttgagcatgttggtggagacatgtttgtcagtattccaaaggctgatgctgtttttatgaagtggatttgtcatgactggagtgatgagcactgcttgaaatttttgaagaactgctatgaggcactgccagacaatggaaaagtgattgtggcagaatgcatacttccagtggctccagattcaagcctggccacaaaaggtgtggttcacattgatgtgatcatgttggctcataatcctggtgggaaagagagaacacaaaaagagtttgaggatcttgccaaaggtgctggattccaaggtttcaaagtccattgtaatgctttcaacacatacatcatggagtttcttaagaaggtttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I742109_sequence 1 ctcaaggaggtactagatgggttcaacaggtgaaactcaaataacaccaacccacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcttcagttcttcccatgattttgaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctaccaacaactaaccctgatgcaccagttatgttggaccgaatgttgcgtctcttggcttgttacataatcctcacatgttcagttcgtactcaacaagatggaaaggttcagagactttatggtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaatctcatgaatcaggataaagtgctcatggaaagctggtaccacctaaaagatgcagtccttgatgggggcattccattcaacaaggcttatggaatgacagcctttgaataccatggaacagatccaaggtttaacaaggttttcaacaaggggatgtctgatcactctaccatcacaatgaagaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtggtggtactggagctgtaattaacacgattgtctcaaaatatcccactataaagggtataaattttgatttaccccatgtcattgaagatgctccatcttatccaggagttgagcatgttggtggagacatgtttgtcagtattccaaaggctgatgctgtttttatgaagtggatttgtcatgactggagtgatgagcactgcttgaaatttttgaagaactgctatgaggcactgccagacaatggaaaagtgattgtggcagaatgcatacttccagtggctccagattcaagcctggccacaaaaggtgtggttcacattgatgtgatcatgttggctcataatcctggtgggaaagagagaacacaaaaagagtttgaggatcttgccaaaggtgctggattccaaggtttcaaagtccattgtaatgctttcaacacatacatcatggagtttcttaagaaggtttaataa BBa_I742107_sequence 1 atgggttcaacaggtgaaactcaaataacaccaacccacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcttcagttcttcccatgattttgaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctaccaacaactaaccctgatgcaccagttatgttggaccgaatgttgcgtctcttggcttgttacataatcctcacatgttcagttcgtactcaacaagatggaaaggttcagagactttatggtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaatctcatgaatcaggataaagtgctcatggaaagctggtaccacctaaaagatgcagtccttgatgggggcattccattcaacaaggcttatggaatgacagcctttgaataccatggaacagatccaaggtttaacaaggttttcaacaaggggatgtctgatcactctaccatcacaatgaagaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtggtggtactggagctgtaattaacacgattgtctcaaaatatcccactataaagggtataaattttgatttaccccatgtcattgaagatgctccatcttatccaggagttgagcatgttggtggagacatgtttgtcagtattccaaaggctgatgctgtttttatgaagtggatttgtcatgactggagtgatgagcactgcttgaaatttttgaagaactgctatgaggcactgccagacaatggaaaagtgattgtggcagaatgcatacttccagtggctccagattcaagcctggccacaaaaggtgtggttcacattgatgtgatcatgttggctcataatcctggtgggaaagagagaacacaaaaagagtttgaggatcttgccaaaggtgctggattccaaggtttcaaagtccattgtaatgctttcaacacatacatcatggagtttcttaagaaggtttaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_J15001_sequence 1 ctcaaggagg BBa_J23118_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z