BBa_K1130000 1 BBa_K1130000 Constitutive promoter 1 L.plantarum 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z Synthetic Promoter derived from rRNA promoters extracted from the L. plantarum WCFS1 genome. The consensus sequence is part of the L.planatarum library that induce gene expression in L. plantarum and Lactobacillus sakei. Some promoters strengths from the library was obtained with the approach, covering 3???4 logs of expression levels in small increments of activity. The SPL was evaluated for the ability to drive GFP expression. false false _1442_ 0 13583 9 It's complicated false Biobricks prefix and subffix was add to the sequence false Alicia Gabriela Quiroz Rocha annotation2357096 1 promoter range2357096 1 1 60 BBa_K1130000_sequence 1 agatctgtcgtggcagttgttgacaacctgtgggcggtttgatttgttcttgctatagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z