BBa_K1130001 1 BBa_K1130001 Constitutive promoter 2 L.plantarum 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z Synthetic promoter derived from rRNA promoters extracted from the L. plantarum WCFS1 genome Synthetic promer was taken from a synthetic promter library for Lactobacillus plantarum, which generalizes the approach for obtaining synthetic promoters. The promoter strength was obtained with the approach, covering3???4 logs of expression levels in small increments of activity. High correlation was obtained between the activities of promoters when tested in L. sakei and L. plantarum, which indicates the potential of the SPL for other Lactobacillus species. The SPL enables fine-tuning of stable gene expression for various applications in L. plantarum. false false _1442_ 0 13583 9 It's complicated false Biobricks prefix and suffix was add to the sequence false Alicia Gabriela Quiroz Rocha BBa_K1130001_sequence 1 agatctgcatcgtaagttgttgacatggaacgaggaatgtgataatctgtgagtatagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z