BBa_K113011 1 BBa_K113011 more overlapping T7 promoter 2008-10-25T11:00:00Z 2015-05-08T01:09:20Z The sequence of T7 promoter is TAATACGACTCACTATA (from 5' to 3'). Two T7 promoters are reversely overlapping in five base pairs, with the third one mutated from A to G. false false _254_ 0 2711 9 It's complicated false It is difficult to make this short DNA by PCR as both sides are T7 promoters, which are very similar. It is highly possible that they form loops before they can be synthesized by PCR. Thus we order two single stranded DNA and then anneal them together by touchdown PCR. false Wu Jingjing, Wang Jinyu annotation1989380 1 T7 promoter range1989380 1 17 34 annotation1989359 1 T7 promoter range1989359 1 4 21 BBa_K113011_sequence 1 cccctatagtgagtcgtactacgactcactatagggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z