BBa_K113018 1 BBa_K113018 weaken overlapping T7 promoter->GFP/RFP 2008-10-25T11:00:00Z 2015-05-08T01:09:20Z BBa_I719015 E1010 T7 terminator + GFP + RBS + T7 promoter (weaken overlapping) T7 promoter + RBS + RFP + T7 terminator The left side of T7 promoter + RBS + GFP + T7T is in the antisense strand while the right side is in the sense strand. T7 promoters are overlapping only two base pairs while its 12th nucleotide is mutated from A to T. false false _254_ 0 2711 9 Not in stock false Still, we cannot find an appropriate way to detect GFP. false Wu Jingjing, Wang Jinyu component2276572 1 BBa_K113012 component2276577 1 BBa_E1010 component2276567 1 BBa_E0040 component2276569 1 BBa_B0034 component2276584 1 BBa_B0015 component2276565 1 BBa_B0015 component2276574 1 BBa_B0034 annotation2276565 1 BBa_B0015 range2276565 1 1 129 annotation2276584 1 BBa_B0015 range2276584 1 1664 1792 annotation2276577 1 BBa_E1010 range2276577 1 950 1655 annotation2276572 1 BBa_K113012 range2276572 1 884 923 annotation2276574 1 BBa_B0034 range2276574 1 932 943 annotation2276569 1 BBa_B0034 range2276569 1 864 875 annotation2276567 1 BBa_E0040 range2276567 1 136 855 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K113012 1 BBa_K113012 weaken overlapping T7 promoter 2008-10-25T11:00:00Z 2015-05-08T01:09:20Z The sequence of T7 promoter is TAATACGACTCACTATA (from 5' to 3'). Two T7 promoters are reversely overlapping in two base pairs while a point mutation occurs at the 12th base pair, from A-T to T-A. false false _254_ 0 2711 9 It's complicated false It is difficult to make this short DNA by PCR as both sides are T7 promoters, which are very similar. It is highly possible that they form loops before they can be synthesized by PCR. Thus we order two single stranded DNA and then anneal them together by touchdown PCR. false Wu Jingjing, Wang Jinyu annotation1989402 1 T7 promoter range1989402 1 20 37 annotation1989400 1 T7 promoter range1989400 1 4 21 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K113018_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaagaggagaaatactagagcccctatagagagtcgtattaatacgactctctataggggtactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K113012_sequence 1 cccctatagagagtcgtattaatacgactctctatagggg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z