BBa_K1132005 1 BBa_K1132005 R0 riboregulator switch with pTET and pLuxRCI 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z later The R0 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false false _1444_ 0 16633 9 It's complicated false The R0 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false iGEM Toulouse annotation2357033 1 BBa_R0065 - pLuxRCI range2357033 1 293 389 annotation2357034 1 Bam HI site range2357034 1 390 395 annotation2357031 1 BBa_B0015-Double terminator range2357031 1 120 286 annotation2357035 1 P2 riboregulation sequence range2357035 1 396 435 annotation2357032 1 Cla I site range2357032 1 287 292 annotation2356921 1 BBa_R0040 pTET range2356921 1 1 54 annotation2356976 1 P1 riboregulation sequence range2356976 1 55 119 BBa_K1132005_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacacccaaatccaggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatcaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttatcgattaagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgataggatcctaccattcacctcttggatttgggtattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z