BBa_K1132006 1 BBa_K1132006 R1 riboregulator switch with with pTET and pLuxRCI 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z later The R1 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false false _1444_ 0 16633 9 In stock false The R1 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false iGEM Toulouse annotation2357037 1 P1 riboregulation sequence range2357037 1 55 119 annotation2357036 1 BBa_R0040 - pTET range2357036 1 1 54 annotation2357039 1 Cla I site range2357039 1 287 292 annotation2357041 1 Bam HI site range2357041 1 390 395 annotation2357038 1 BBa_B0015 - Double terminator range2357038 1 120 286 annotation2357040 1 BBa_R0065 - pLuxRCI range2357040 1 293 389 annotation2357042 1 P2 riboregulation sequence range2357042 1 396 435 BBa_K1132006_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacacccactcaatggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatcaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttatcgattaagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgataggatcctaccattcacctctattgagtgggtattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z