BBa_K1132007 1 BBa_K1132007 R2 riboregulator switch with with pTET and pFixJ 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z later The R2 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false false _1444_ 0 16633 9 In stock false The R2 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false iGEM Toulouse annotation2357057 1 P2 riboregulation sequence range2357057 1 549 588 annotation2357053 1 BBa_B0015 - Double terminator range2357053 1 120 286 annotation2357051 1 BBa_R0040 - pTET range2357051 1 1 54 annotation2357056 1 Bam HI site range2357056 1 543 548 annotation2357054 1 Cla I site range2357054 1 287 292 annotation2357052 1 P1 riboregulation sequence range2357052 1 55 119 annotation2357055 1 BBa_K592006 - PFixJ range2357055 1 293 542 BBa_K1132007_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaccaaactaccggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatcaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttatcgatgccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcacaggatcctaccattcacctctggtagtttggtattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z