BBa_K1132008 1 BBa_K1132008 R4 riboregulator switch with with pTET and pOmpC 2013-09-19T11:00:00Z 2015-05-08T01:09:20Z later The R4 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false false _1444_ 0 16633 9 It's complicated false The R4 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false iGEM Toulouse annotation2357060 1 BBa_B0015 - Double terminator range2357060 1 120 286 annotation2357062 1 BBa_R0082 - pOmpR range2357062 1 293 400 annotation2357064 1 P2 riboregulation sequence range2357064 1 407 446 annotation2357061 1 Cla I site range2357061 1 287 292 annotation2357058 1 BBa_R0040 - pTET range2357058 1 1 54 annotation2357063 1 Bam HI site range2357063 1 401 406 annotation2357059 1 P1 riboregulation sequence range2357059 1 55 119 BBa_K1132008_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaccaccactaaggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatcaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttatcgattcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactggatcctaccattcacctctttagtggtggtattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z