BBa_K137007 1 BBa_K137007 fimE 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE gene false false _187_ 0 3112 9 It's complicated false none false Allen Lin BBa_B1010 1 BBa_B1010 Terninator (artificial, large, %T~<10) 2006-09-06T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~<10% 8bp stem, 6nt loop Bidirectional, estimated reverse %T~=40% false false _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be more effective than the forward. Has a polyA tail of 3 residues. true Haiyao Huang annotation1901015 1 PolyA range1901015 1 7 9 annotation1901016 1 PolyA range1901016 1 32 34 annotation1901013 1 B1010 range1901013 1 1 40 annotation1901014 1 modified thr terminator range1901014 1 10 31 BBa_K1132025 1 BBa_K1132025 FimE integrase coding sequence with constitutive weak promoter and terminator. 2013-09-19T11:00:00Z 2015-05-08T01:09:21Z later FimE integrase allows DNA 180?? switching between two recognition sites (IRL : BBa_K137010 and IRR : BBa_K137008). As the protein is very active even at low level of expression, it is associated with a constitutive weak promoter. false false _1444_ 0 16633 9 It's complicated false FimE integrase allows DNA 180?? switching between two recognition sites (IRL : BBa_K137010 and IRR : BBa_K137008). As the protein is very active even at low level of expression, it is associated with a constitutive weak promoter. false iGEM Toulouse component2356477 1 BBa_K137007 component2356476 1 BBa_B0034 component2356482 1 BBa_B1010 component2356474 1 BBa_K823013 annotation2356476 1 BBa_B0034 range2356476 1 44 55 annotation2356477 1 BBa_K137007 range2356477 1 62 619 annotation2356474 1 BBa_K823013 range2356474 1 1 35 annotation2356482 1 BBa_B1010 range2356482 1 628 667 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K823013 1 BBa_K823013 Anderson promoter J23117 2012-09-07T11:00:00Z 2015-07-07T11:51:22Z Partsregistry Released HQ 2013 Anderson promoter J23117 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182545 1 -10 box range2182545 1 24 29 annotation2182544 1 -35 box range2182544 1 1 6 annotation2182543 1 J23117 range2182543 1 1 35 BBa_B0034_sequence 1 aaagaggagaaa BBa_B1010_sequence 1 cgccgcaaaccccgcccctgacagggcggggtttcgccgc BBa_K137007_sequence 1 atgatgcaggcggtttgttacggggcaacgggagccagagattattgtcttattctgttggcatatcggcatgggatgcgtattagtgaactgcttgatctgcattatcaggaccttgaccttaatgaaggtagaataaatattcgccgactgaagaacggattttctaccgttcacccgttacgttttgatgagcgtgaagccgtggaacgctggacccaggaacgtgctaactggaaaggcgctgaccggactgacgctatatttatttctcgccgcgggagtcggctttctcgccagcaggcctatcgcattattcgcgatgccggtattgaagctggaaccgtaacgcagactcatcctcatatgttaaggcatgcttgcggttatgaattggcggagcgtggtgcagatactcgtttaattcaggattatctcgggcatcgaaatattcgccatactgtgcgttataccgccagtaatgctgctcgttttgccggattatgggaaagaaataatctcataaacgaaaaattaaaaagagaagaggtttaataa BBa_K823013_sequence 1 ttgacagctagctcagtcctagggattgtgctagc BBa_K1132025_sequence 1 ttgacagctagctcagtcctagggattgtgctagctactagagaaagaggagaaatactagatgatgcaggcggtttgttacggggcaacgggagccagagattattgtcttattctgttggcatatcggcatgggatgcgtattagtgaactgcttgatctgcattatcaggaccttgaccttaatgaaggtagaataaatattcgccgactgaagaacggattttctaccgttcacccgttacgttttgatgagcgtgaagccgtggaacgctggacccaggaacgtgctaactggaaaggcgctgaccggactgacgctatatttatttctcgccgcgggagtcggctttctcgccagcaggcctatcgcattattcgcgatgccggtattgaagctggaaccgtaacgcagactcatcctcatatgttaaggcatgcttgcggttatgaattggcggagcgtggtgcagatactcgtttaattcaggattatctcgggcatcgaaatattcgccatactgtgcgttataccgccagtaatgctgctcgttttgccggattatgggaaagaaataatctcataaacgaaaaattaaaaagagaagaggtttaataatactagagcgccgcaaaccccgcccctgacagggcggggtttcgccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z