BBa_K1132042 1 BBa_K1132042 R1-pLac riboregulator switch with with pTET and pLac 2013-09-19T11:00:00Z 2015-05-08T01:09:21Z later The R4 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false false _1444_ 0 16633 9 In stock false The R4 riboregulator sequence is designed based on the publication of Callura JM (http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/22454498). The principle is to introduce short regulatory sequences that create RNA secondary structures to better control protein expression. The basic design is reported in the following scheme (red hexagonal boxes, terminators; green oval box, rbs; blue and red rectangles, riboregulator sequences; arrows, promoters). Promoters P1 and P2 are controlling the expression of a single gene X (not present in the biobrick). Two terminators are placed between P1 and P2. false Cl??mence Mesnage annotation2357086 1 BBa_R0040 - pTET range2357086 1 1 54 annotation2358883 1 P2 riboregulation sequence range2358883 1 354 393 annotation2358881 1 BBa_R0011 - pLac range2358881 1 293 347 annotation2358882 1 Bam HI site range2358882 1 348 353 annotation2358879 1 BBa_B0015 - Double terminator range2358879 1 120 286 annotation2358878 1 P1 riboregulation sequence range2358878 1 55 119 annotation2358880 1 Cla I site range2358880 1 287 292 BBa_K1132042_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacacccactcaatggaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatcaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttatcgataattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacaggatcctaccattcacctctattgagtgggtattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z