BBa_K1137011 1 BBa_K1137011 sRNA anti lac 2013-09-22T11:00:00Z 2015-05-08T01:09:21Z gBlock Synthesis with sRNA design from "Design and use of synthetic regulatory small RNAs to control gene expression in Escherichia coli" Yoo et al 2013 Nature Protocols A small RNA that inhibits lacZ in E. coli. Contains PR promotor, sRNA, Scaffold from MicC and T1/TE. sRNA can be modified quickly and easily via site specific mutagenesis with primers. false false _1449_ 0 15098 9 In stock false The Sequence of the sRNA must match exactly the target sequence for silencing. Therefore we needed to sequence the available lacZ to design our sRNA. If users lacZ has any point mutations, silent or otherwise, silencing may not occur. false Matthew Deyell BBa_K1137011_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgccagtgaatccgtaatcatggtcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttctcgagctcgagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgtttttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z