BBa_K1137012 1 BBa_K1137012 gRNA anti KAN 2013-10-03T11:00:00Z 2015-05-08T01:09:21Z This part was synthesized by IDT, the design is derived from the paper below. James E. DiCarlo, Julie E. Norville, Prashant Mali, Xavier Rios, John Aach and George M. Church (2013): Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research, 2013, 1???8. This rather simple part contains the UG6 promoter that controls the gRNA anti KAN cassette. This cassette consists of a seed sequence of the Kanamycin resistance gene (Aminoglycoside N6???-acetyltransferase) and the gRNA scaffold. This part is ready to use and can generate together with the CAS9 a double strand break in the kanamycin resistance gene. By definition, the gRNA is hybrid RNA out of the crRNA and tracrRNA. The gRNA is necessary to guide the CAS9 to the specific site and to cause there a double strand break. The design of the gRNA is taken from the DiCarlo et al. 2013 paper. false false _1449_ 0 11926 9 It's complicated false - false Nicolas Koutsoubelis, Anne Loechner BBa_K1137012_sequence 1 tgtacaaaaaagcaggctttaaaggaaccaattcagtcgactggatccggtaccaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgatcatcctgatcgacaagacgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttctagacccagctttcttgtacaaagttggcatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z