BBa_K1137013 1 BBa_K1137013 crRNA anti KAN 2013-10-03T11:00:00Z 2015-05-08T01:09:21Z This part was synthesized by IDT. THe design was taken from the paper below: Wenyan Jiang, David Bikard, David Cox, Feng Zhang & Luciano A Marraffini (2013): RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nature Biotechnology 31 (3), 233-239. This rather simple part contains the crRNA. The crRNA contains the target sequence to which the Cas9 protein is guided. The crRNA part can be cloned in front of any promoter. Note, that no RBS should be between the promoter and the crRNA. The crRNA is one of the two RNAs (crRNA and tracrRNA) that are needed to build the RNA dimer complex that fuses with the Cas9. The crRNA and the tracrRNA dimerize and are processed. This complex then binds to the CAS9. The RNA hybrid guides the Cas9 to its target and the Cas9 generates a site-specific double strand break. This crRNA here encodes for a sequence of the Kanamycin resistance gene cassette. The design of the crRNA is taken from the Jian et al. 2013 paper. false false _1449_ 0 11926 9 It's complicated false - false Nicolas Koutsoubelis, Anne Loechner BBa_K1137013_sequence 1 tatttcttaataactaaaaatatggtataatactcttaataaatgcagtaatacaggggcttttcaagactgaagtctagctgagacaaatagtgcgattacgaaattttttagacaaaaatagtctacgaggttttagagctatgctgttttgaatggtcccaaaactatcatcctgatcgacaagacgttttagagctatgctgttttgaatggtcccaaaacttcagcacactgagacttgttgagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z