BBa_K1140000 1 BBa_K1140000 RBS + TetR (LVA) 2013-08-28T11:00:00Z 2015-05-08T01:09:22Z The pTetR promoter, RFP-LVA coding region and the RBS are BioBricks pieces. This synthesised construction has a gene that codes for the red fluorescent protein (RFP) variant that has an LVA degradation tag. The LVA tag that is in frame with the coding sequence of the gene, is actually a derivation of the C-terminal AANDENYALAA tagging sequence, which makes proteins susceptible to degradation by the ClpX and ClpA proteases. This gene is under the regulation of a pTetR promoter The coding sequence of TetR was derived from part BBa_C0040. TetR is a member of a family of transcriptional repressors present in gram-positive, alpha-,beta-, and gamma-proteobacteria, cyanobacteria and archea. Its follows by a thermo-switch/ribosome binding site (RBS) that should allow for translation only at temperatures since 37??C. The RBS sequence is derived from part BBa_B0034, which features in the 2010 study by Elowtiz and Leibler. This RBS is defined as the standard for RBS activity and is assigned an efficiency of 1.0. The Terminator false false _1452_ 0 8594 9 It's complicated false The thermo-switch/ribosome binding site was designed to denature since 37??C and above. It will allow the RFP expression since 37??C. false Janssel Reyes del Castillo annotation2338306 1 T7 double terminator range2338306 1 689 732 annotation2338304 1 RBS range2338304 1 1 12 annotation2338305 1 TetR range2338305 1 21 680 BBa_K1140000_sequence 1 aaagaggagaaatactagagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataatactagagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z