BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2022 1 -10 range2022 1 38 43 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2024 1 OR1 range2024 1 25 41 BBa_K1140000 1 BBa_K1140000 RBS + TetR (LVA) 2013-08-28T11:00:00Z 2015-05-08T01:09:22Z The pTetR promoter, RFP-LVA coding region and the RBS are BioBricks pieces. This synthesised construction has a gene that codes for the red fluorescent protein (RFP) variant that has an LVA degradation tag. The LVA tag that is in frame with the coding sequence of the gene, is actually a derivation of the C-terminal AANDENYALAA tagging sequence, which makes proteins susceptible to degradation by the ClpX and ClpA proteases. This gene is under the regulation of a pTetR promoter The coding sequence of TetR was derived from part BBa_C0040. TetR is a member of a family of transcriptional repressors present in gram-positive, alpha-,beta-, and gamma-proteobacteria, cyanobacteria and archea. Its follows by a thermo-switch/ribosome binding site (RBS) that should allow for translation only at temperatures since 37??C. The RBS sequence is derived from part BBa_B0034, which features in the 2010 study by Elowtiz and Leibler. This RBS is defined as the standard for RBS activity and is assigned an efficiency of 1.0. The Terminator false false _1452_ 0 8594 9 It's complicated false The thermo-switch/ribosome binding site was designed to denature since 37??C and above. It will allow the RFP expression since 37??C. false Janssel Reyes del Castillo annotation2338306 1 T7 double terminator range2338306 1 689 732 annotation2338305 1 TetR range2338305 1 21 680 annotation2338304 1 RBS range2338304 1 1 12 BBa_K1140004 1 BBa_K1140004 pLambdaCI + TetR (LVA) 2013-09-09T11:00:00Z 2015-05-08T01:09:23Z This part is a composite constructed with BBa_R0051 and BBa_K1140000. TetR protein is regulated by the promoter "pLamdbaCI". false false _1452_ 0 12878 9 Not in stock false Prefix: EcoRI and XbaI Sufix: SpeI and PstI false Janssel Reyes del Castillo component2338316 1 BBa_R0051 component2338323 1 BBa_K1140000 annotation2338316 1 BBa_R0051 range2338316 1 1 49 annotation2338323 1 BBa_K1140000 range2338323 1 58 789 BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_K1140004_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataatactagagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K1140000_sequence 1 aaagaggagaaatactagagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataatactagagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z