BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049253 1 AraI1 range2049253 1 40 57 annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049252 1 promoter range2049252 1 1 131 BBa_K174000 1 BBa_K174000 SspB proteolysis chaperone 2009-09-25T11:00:00Z 2015-05-08T01:10:58Z 498 bp long sspB CDS is amplified by PCR with dangling end primers with EcoRI-NotI-XbaI restriction site at 5??? and SpeI at 3??? and inserted into a Biobrick compatible vector. The sequence is taken from E. coli strain DH5 alpha. Genbank accession number for E. coli MG1655 strain is NC_000913.2 SspB protein targets proteins tagged with modified degradation tag, ssrA, and deliver them to ClpXP for proteolysis. Modified ssrA tags are fused onto the 3??? end of a gene. false false _277_ 0 3942 9 It's complicated false Forward primer used: GATCTG-GAATTCGCGGCCGCTTCTAG-ATGGATTTGTCACAGCTAAC (Clamp sequence - Standard Biobrick prefix - first 20 base from the Biobrick) Reverse primer used: TGTGAC-ACTAGTA-TTACTTCACAACGCGTAATGC (Clamp sequence - SpeI site - last 21 base from the Biobrick) false The Newcastle 2009 iGEM team annotation2027215 1 sspB range2027215 1 1 498 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1141006 1 BBa_K1141006 pBad-RBS-sspB 2013-10-03T11:00:00Z 2015-05-08T01:09:26Z This part contains pBad BBa_K206000, RBS elowitz BBa_B0034 and sspb BBa_K174000. This part contains sspB : stringent starvation protein B. When induced with arabinose and c-amp sspB will enhance the degradation rate of any protein tagged with a ssrA-tag false false _1453_ 0 16707 9 Not in stock false The RBS was added by PCR as we struggled isolating it by miniprep. false Sarah Amblard component2367903 1 BBa_B0034 component2367901 1 BBa_K206000 component2367905 1 BBa_K174000 annotation2367905 1 BBa_K174000 range2367905 1 157 654 annotation2367903 1 BBa_B0034 range2367903 1 139 150 annotation2367901 1 BBa_K206000 range2367901 1 1 130 BBa_B0034_sequence 1 aaagaggagaaa BBa_K174000_sequence 1 atggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgtttgagcctgaagctgcctacgatgaagataccagcatcatgaatgatgaagaggcatcggcagacaacgaaaccgttatgtcggttattgatggcgacaagccagatcacgatgatgacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaa BBa_K1141006_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgtttgagcctgaagctgcctacgatgaagataccagcatcatgaatgatgaagaggcatcggcagacaacgaaaccgttatgtcggttattgatggcgacaagccagatcacgatgatgacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z