BBa_K1145005 1 Pλ A promoter which can be inhibited by protein CI 2013-09-13T11:00:00Z 2015-05-08T01:09:26Z It comes from the genome of λ phage. Pλ is a promoter which can be inhibited by protein CI. false false _1457_ 0 16512 9 It's complicated false No. false KUN LV BBa_K1145005_sequence 1 ggttcctagtaaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z