BBa_K1148014 1 BBa_K1148014 promoter hlbA from L. bulgaricus 2013-10-11T11:00:00Z 2015-05-08T01:09:26Z Comes from genomic sequence. Promoter expressed constitutively in a lot of strains of L. bulgaricus. Found in "Highly efficient production of the staphylococcal nuclease reporter in Lactobacillus bulgaricus governed by the promoter of the hlbA gene." false false _1460_ 0 12351 9 Not in stock false none false C??cile Qu??r?? BBa_K1148014_sequence 1 aaagccttgtagggacaacgttcttgtgatattttagagagcagggaattaattgaatgcagcaagcgctcagtgtccctcatttctacaagagaaatgaagtgattagacgcgagtctaatttataggaggtgaattccacatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z