BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1149021 1 BBa_K1149021 Promoter J23104 - RBS B0034 -LARD1 2013-09-07T11:00:00Z 2015-05-08T01:09:26Z Erwinia chrysanthemi It is a composite of BBa_K608002 (http://parts.igem.org/Part:BBa_K592009) (promoter-RBS) and BBa_K258001 http://parts.igem.org/Part:BBa_K258001 (LARD1). This construct will make it easier for anyone to create a LARD1-anyprotein fusion for secretion outside the cell. Please find instructions and help with creating a fusion protein on the Imperial COllege 2013 iGEM team???s secretion page. false false _1461_ 0 17968 9 In stock false This part is designed to be used together with BBa_K258008 (http://parts.igem.org/Part:BBa_K258008) ABC transporter. false Margarita Kopniczky component2335460 1 BBa_K608002 component2335461 1 BBa_K258001 annotation2335461 1 BBa_K258001 range2335461 1 64 591 annotation2335460 1 BBa_K608002 range2335460 1 1 55 BBa_K608002 1 BBa_K608002 strong Promoter and strong RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z assembly from iGEM parts Released HQ 2013 you can insert your part behind this part so it will be immediatly expressed in e.coli. false false _780_ 0 9115 9 In stock false cloning via 3a-assembly false Julia M??ller component2128646 1 BBa_J23104 component2128648 1 BBa_B0034 annotation2128646 1 BBa_J23104 range2128646 1 1 35 annotation2128648 1 BBa_B0034 range2128648 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K258001 1 BBa_K258001 Lipase ABC transporter recognition domain (LARD 1) 2009-10-02T11:00:00Z 2015-05-08T01:11:42Z LARD 1 composed of residues 303-476 of thermostable lipase (TliA) of Pseudomonas fluorescens. Lard 1 was designed for the secretion of fusion proteins.The LARD 1 included four glycine-rich repeats comprising a &#946;-roll structure, and were added to the C-terminus of test proteins. Either Pro-Gly linker or Factor Xa site can be added between fusion proteins and LARD 1. Upon supplementation of E. coli with ABC transporter from E. chrysanthemi (ABC transporter PrtDEF), which function well in the phylogenetically-neighboring genus E.coli, EGF-LARDs were excreted into the culture supernatant. false false _358_ 0 4260 9 It's complicated true In our designed LARD 1, we favoured not to add these cleavage site so if you want, yo can add either Pro-Gly linker or Factor Xa site. Secretion of fusion proteins with LARDs could be detected by Western blotting. Fusion proteins were traced in the culture supernatant using antibody against LARDs. Polyclonal antibodies against the C-terminal signal sequence were produced with a synthetic peptide (YQPTDRLVFQGADGST, residues 421???436 of TliA ,also of LARD). false Jung Hoon Ahn from Korea Advanced Institute of Science and Technology BBa_B0034_sequence 1 aaagaggagaaa BBa_K608002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_K1149021_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagagagcattgccaacctgtccacatgggtgtcacatctgccttcagcctatggtgatggtatgactcgtgtgctggaatctggcttttatgagcaaatgactcgtgatagtacgattattgtcgctaacctgtctgatccggctcgtgccaacacttgggttcaagacctgaaccgtaatgctgaacctcatacgggtaacacctttatcattgggtccgatgggaacgatctgattcaaggcggcaaaggagcggatttcatcgagggtggaaaaggcaacgacaccatccgtgacaattctgggcataacacgtttctgttttcgggccattttggtcaggatcgtatcatcggctatcagccgaccgatcgtctggtgtttcaaggtgctgatggttcaaccgatctgcgtgatcatgccaaagcagttggtgccgacacagttctgtcttttggagctgactcagtgactctggtgggagttggtctgggtggtctgtggtctgagggtgtactgattagctactag BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_K258001_sequence 1 agcattgccaacctgtccacatgggtgtcacatctgccttcagcctatggtgatggtatgactcgtgtgctggaatctggcttttatgagcaaatgactcgtgatagtacgattattgtcgctaacctgtctgatccggctcgtgccaacacttgggttcaagacctgaaccgtaatgctgaacctcatacgggtaacacctttatcattgggtccgatgggaacgatctgattcaaggcggcaaaggagcggatttcatcgagggtggaaaaggcaacgacaccatccgtgacaattctgggcataacacgtttctgttttcgggccattttggtcaggatcgtatcatcggctatcagccgaccgatcgtctggtgtttcaaggtgctgatggttcaaccgatctgcgtgatcatgccaaagcagttggtgccgacacagttctgtcttttggagctgactcagtgactctggtgggagttggtctgggtggtctgtggtctgagggtgtactgattagctactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z