BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966896 1 SD range1966896 1 90 95 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z