BBa_K115004 1 BBa_K115004 A temperature sensitive 5 2008-07-15T11:00:00Z 2015-05-08T01:09:27Z The sequence is based on the paper "RNA Quadruplex-Based Modulation of Gene Expression" by Markus Wieland and Jorg S. Hartig. This part is designed as a temperature inducible RBS. Only designed so far. true false _223_ 0 3006 9 Discontinued false The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. false Bastiaan van den Berg annotation1967317 1 His-Tag range1967317 1 42 71 annotation1967315 1 SD range1967315 1 22 28 annotation1967316 1 start range1967316 1 36 38 BBa_K115004_sequence 1 aataattttgtttaagtgtgggaaggagggtgtgcatgggccatcatcatcatcatcatcatcatcatcacagcagcggccatatcgaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z